miRBase entry: tgu-mir-367

Stem-loop tgu-mir-367


Accession
MI0022172
Description
Taeniopygia guttata tgu-mir-367 precursor miRNA


Sequence


aggcuaauacuguugcuaauaugcaacucuguuguauaaaaauuggAAUUGCACUUUAGCAAUGGUGAuggacug
((.(((.((((((((((((..(((((.((((.(........).)))).)))))..)))))))))))).))).)).

Structure
-  g   a            ua     c    u gua 
 ag cua uacuguugcuaa  ugcaa ucug u   u
 || ||| ||||||||||||  ||||| |||| |    
 uc ggu GUGGUAACGAUU  ACGUU Aggu a   a
g  a   A            UC     A    u aaa 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr4: 2681244-2681318 [-]

Database links

Mature tgu-miR-367

Accession MIMAT0025395
Description Taeniopygia guttata tgu-miR-367 mature miRNA
Sequence 47 - AAUUGCACUUUAGCAAUGGUGA - 68
Evidence not_experimental

References

  1. PubMed ID: 21210939
    microRNA complements in deuterostomes: origin and evolution of microRNAs
    "Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M"
    "Evol Dev (2011) 13:15-27