miRBase entry: hsa-mir-6818

Stem-loop hsa-mir-6818


Accession
MI0022663
Symbol
HGNC: MIR6818
Description
Homo sapiens hsa-mir-6818 precursor miRNA


Sequence

168 reads, 2 reads per million, 35 experiments
cuauuUUGUGUGAGUACAGAGAGCAUCugaauggguacaguugUUGUCUCUUGUUCCUCACACAG
......((((((((.((((((((((.(((........))).)))..)))).)))..)))))))).

Structure
cuauuU        -U   -    --   U   aau 
      UGUGUGAG  ACA GAGA  GCA Cug   g
      ||||||||  ||| ||||  ||| |||    
      ACACACUC  UGU CUCU  Ugu gac   g
-----G        CU   U    GU   u   aug 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr22: 30007049-30007113 [+]

Disease association
hsa-mir-6818 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-6818-5p

Accession MIMAT0027536
Description Homo sapiens hsa-miR-6818-5p mature miRNA
Sequence 6 - UUGUGUGAGUACAGAGAGCAUC - 27
Evidence experimental
meta-analysis [1]

Mature hsa-miR-6818-3p

Accession MIMAT0027537
Description Homo sapiens hsa-miR-6818-3p mature miRNA
Sequence 44 - UUGUCUCUUGUUCCUCACACAG - 65
Evidence experimental
meta-analysis [1]

References

  1. PubMed ID: 22955976
    Discovery of hundreds of mirtrons in mouse and human small RNA data
    "Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC"
    "Genome Res (2012) 22:1634-1645