miRBase entry: hsa-mir-6874

Stem-loop hsa-mir-6874


Accession
MI0022721
Symbol
HGNC: MIR6874
Description
Homo sapiens hsa-mir-6874 precursor miRNA


Sequence

52 reads, 1 reads per million, 20 experiments
gccacAUGGAGCUGGAACCAGAUCAGGCuuuaauguuugaaguaauguCAGUUCUGCUGUUCUGACUCUAG
......(((((.((((((((((((((((......))))))............))))..)))))).))))).

Structure
gccacA     C      --    ------------      uu 
      UGGAG UGGAAC  CAGA            UCAGGC  u
      ||||| ||||||  ||||            ||||||   
      AUCUC GUCUUG  GUCU            aguuug  a
-----G     A      UC    UGACuguaauga      ua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr7: 5711840-5711910 [-]

Disease association
hsa-mir-6874 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-6874-5p

Accession MIMAT0027648
Description Homo sapiens hsa-miR-6874-5p mature miRNA
Sequence 6 - AUGGAGCUGGAACCAGAUCAGGC - 28
Evidence experimental
meta-analysis [1]

Mature hsa-miR-6874-3p

Accession MIMAT0027649
Description Homo sapiens hsa-miR-6874-3p mature miRNA
Sequence 49 - CAGUUCUGCUGUUCUGACUCUAG - 71
Evidence experimental
meta-analysis [1]

References

  1. PubMed ID: 22955976
    Discovery of hundreds of mirtrons in mouse and human small RNA data
    "Ladewig E, Okamura K, Flynt AS, Westholm JO, Lai EC"
    "Genome Res (2012) 22:1634-1645