miRBase entry: bfl-mir-34c-2

Stem-loop bfl-mir-34c-2


Accession
MI0023543
Description
Branchiostoma floridae bfl-mir-34c-2 precursor miRNA


Sequence


accucgugcagccaucuggcaguguuguuagcuggccgcuaggagucgcucuuuagGCCCUCUAUCAACGCUGCCCUAcggaagcgcgacac
...((((((..((....((((((((((.(((..((((...(((((...)))))..))))..))).))))))))))....))..))))))...

Structure
acc      ag  aucu          u   cu    gcu     u 
   ucgugc  cc    ggcaguguug uag  ggcc   aggag  
   ||||||  ||    |||||||||| |||  ||||   ||||| c
   agcgcg  gg    CCGUCGCAAC AUC  CCGg   uucuc  
cac      aa  cAUC          U   UC    -au     g 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
GG666704.1: 335461-335552 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from bfl-mir-34c-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bfl-miR-34c

Accession MIMAT0020451
Description Branchiostoma floridae bfl-miR-34c mature miRNA
Sequence 57 - GCCCUCUAUCAACGCUGCCCUA - 78
Evidence experimental
454 [1]

References

  1. PubMed ID: 21210939
    microRNA complements in deuterostomes: origin and evolution of microRNAs
    "Campo-Paysaa F, Semon M, Cameron RA, Peterson KJ, Schubert M"
    "Evol Dev (2011) 13:15-27