miRBase entry: bdi-MIR9495

Stem-loop bdi-MIR9495


Accession
MI0029146
Description
Brachypodium distachyon bdi-MIR9495 precursor miRNA


Sequence


uuuUGAAAAAUGCCUCUGGACGUGucaaugucuuguaggaucuggacccacguaucauucucacauccaguggcauuuuucgaaaug
((((((((((((((.(((((.(((..((((...(((.((........)))))...))))..))).))))).))))))))))))))..

Structure
--              U     C   uc    ucu   a  auc 
  uuuUGAAAAAUGCC CUGGA GUG  aaug   ugu gg   u
  |||||||||||||| ||||| |||  ||||   ||| ||    
  aaagcuuuuuacgg gaccu cac  uuac   gca cc   g
gu              u     a   uc    uau   -  cag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
3: 7679238-7679324 [-]

Database links

Mature bdi-miR9495

Accession MIMAT0035504
Description Brachypodium distachyon bdi-miR9495 mature miRNA
Sequence 4 - UGAAAAAUGCCUCUGGACGUG - 24
Evidence not_experimental

References

  1. PubMed ID: 24367943
    Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon
    Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ
    Genome Biol (2013) 14:R145