miRBase entry: bdi-MIR5181e

Stem-loop bdi-MIR5181e


Accession
MI0029184
Description
Brachypodium distachyon bdi-MIR5181e precursor miRNA

Literature search
1 open access papers mention bdi-MIR5181e
(2 sentences)

Sequence


uacucccuccgaaccauaauaagugucugacauuuagcacaaauuuguuaacuucguacuaaaucucCGACACUUACUGUGGCUCGGAgggaguaug
((((((((((((.(((((.((((((((.((.((((((.((...............)).)))))).)).)))))))).))))).))))))))))))..

Structure
--            a     a        u  c      c  aaauuu 
  uacucccuccga ccaua uaaguguc ga auuuag ac      g
  |||||||||||| ||||| |||||||| || |||||| ||      u
  augagggAGGCU GGUGU AUUCACAG cu uaaauc ug      u
gu            C     C        C  c      a  cuucaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
1: 63715748-63715844 [-]

Database links

Mature bdi-miR5181e

Accession MIMAT0035541
Description Brachypodium distachyon bdi-miR5181e mature miRNA
Sequence 68 - CGACACUUACUGUGGCUCGGA - 88
Evidence not_experimental

References

  1. PubMed ID: 24367943
    Parallel analysis of RNA ends enhances global investigation of microRNAs and target RNAs of Brachypodium distachyon
    Jeong DH, Schmidt SA, Rymarquis LA, Park S, Ganssmann M, German MA, Accerbi M, Zhai J, Fahlgren N, Fox SE, Garvin DF, Mockler TC, Carrington JC, Meyers BC, Green PJ
    Genome Biol (2013) 14:R145