Stem-loop gma-MIR9756

Accession

MI0031049

Description

Glycine max gma-MIR9756 precursor miRNA

Sequence

cuauggcccuguuuggguaaaguucucaauaagcacuuauaggaaaagaaauaacaaguuaaaaugaauuaagcuuaucccacaaguuaaauuagcuuuuggaaaaaaaugaaaaaacuuccauaaauuagcuuauacauaaacuaauuuuaacuuaugagggaaguuuaaaucauuuucuaucuauuuucuucuuuuacaagugcucauUGAGAACUUUAUCCAAACAGAGcaaua
.....((.((((((((((((((((((((((.(((((((.(((((.((((((.........(((((((.((((((((.(((((.((((((((..((((..(((((..............)))))......))))...............)))))))).)).))))))))))).)))))))........)))))).))))).))))))).)))))))))))))))))))))).))....

Structure

cuaug  c                      a       a     a      uaacaaguu       a        a   -  c        -------------uu    ----uu     aaaaau 
     gc cuguuuggguaaaguucucaau agcacuu uagga aagaaa         aaaauga uuaagcuu ucc ca aaguuaaa               agcu      uggaa      g
     || |||||||||||||||||||||| ||||||| ||||| ||||||         ||||||| |||||||| ||| || ||||||||               ||||      |||||       
     cG GACAAACCUAUUUCAAGAGUua ucgugaa auuuu uucuuu         uuuuacu aauuugaa ggg gu uucaauuu               ucga      accuu      a
-auaa  A                      c       c     c      -uaucuauc       a        -   a  a        uaaucaaauacauau    uuaaau     caaaaa 

Annotation confidence Not enough data

Genome context

chr18: 43318601-43318837 [+]

Mature gma-miR9756

• Accession: MIMAT0036387
• Description: Glycine max gma-miR9756 mature miRNA
• Sequence: 211 - UGAGAACUUUAUCCAAACAGAG - 232
• Evidence: experimental ; Illumina [1-2]

References

1. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153


2. PubMed ID: 25465409
   An atlas of soybean small RNAs identifies phased siRNAs from hundreds of coding genes
   "Arikit S, Xia R, Kakrana A, Huang K, Zhai J, Yan Z, Valdes-Lopez O, Prince S, Musket TA, Nguyen HT, Stacey G, Meyers BC"
   "Plant Cell (2014) 26:4584-4601