miRBase entry: oha-mir-338

Stem-loop oha-mir-338


Accession
MI0031458
Description
Ophiophagus hannah oha-mir-338 precursor miRNA


Sequence


ccgUCAACAAUAUCCUGGUGCUGAgugaguggcacucggagacUCCAGCAUCAGUGAUUUUGUUGAagaggggg
((.(((((((.(((((((((((((((((((...))))....))).))))))))).))).)))))))...))...

Structure
---  --g       U   -         -   ----    g 
   cc   UCAACAA AUC CUGGUGCUG Agu    gagu  
   ||   ||||||| ||| ||||||||| |||    |||| g
   gg   AGUUGUU UAG GACUACGAC Uca    cuca  
ggg  aga       U   U         C   gagg    c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
AZIM01000013.1: 479336-479409 [-]

Database links

Mature oha-miR-338-5p

Accession MIMAT0036903
Description Ophiophagus hannah oha-miR-338-5p mature miRNA
Sequence 4 - UCAACAAUAUCCUGGUGCUGA - 24
Evidence not_experimental

Mature oha-miR-338-3p

Accession MIMAT0036904
Description Ophiophagus hannah oha-miR-338-3p mature miRNA
Sequence 44 - UCCAGCAUCAGUGAUUUUGUUGA - 66
Evidence not_experimental

References

  1. PubMed ID: 24297900
    The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system
    "Vonk FJ, Casewell NR, Henkel CV, Heimberg AM, Jansen HJ, McCleary RJ, Kerkkamp HM, Vos RA, Guerreiro I, Calvete JJ, Wuster W, Woods AE, Logan JM, Harrison RA, Castoe TA, de Koning AP, Pollock DD, Yandell M, Calderon D, Renjifo C, Currier RB, Salgado D, Pl"
    "Proc Natl Acad Sci U S A (2013) 110:20651-20656