miRBase entry: rno-mir-29c-2

Stem-loop rno-mir-29c-2


Accession
MI0031761
Description
Rattus norvegicus rno-mir-29c-2 precursor miRNA

Literature search
109 open access papers mention rno-mir-29c-2
(688 sentences)

Sequence

325564 reads, 334 reads per million, 492 experiments
aucucuuacacaggcUGACCGAUUUCUCCUGGUGUUCagagucuguuuuugucUAGCACCAUUUGAAAUCGGUUAugauguaggggga
..((((((((((...(((((((((((...(((((((.(((...........))))))))))...))))))))))))).))))))))..

Structure
au        -  ggc           UCC       C   gucu 
  cucuuaca ca   UGACCGAUUUC   UGGUGUU aga    g
  |||||||| ||   |||||||||||   ||||||| |||    u
  ggggaugu gu   AUUGGCUAAAG   ACCACGA Ucu    u
ag        a  ---           UUU       -   guuu 


Annotation confidence High
Do you think this miRNA is real?
Comments
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr13: 113782585-113782672 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from rno-mir-29c-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-29c-5p

Accession MIMAT0003154
Description Rattus norvegicus rno-miR-29c-5p mature miRNA
Sequence 16 - UGACCGAUUUCUCCUGGUGUUC - 37
Evidence experimental
cloned [2], SOLiD [5]

Mature rno-miR-29c-3p

Accession MIMAT0000803
Description Rattus norvegicus rno-miR-29c-3p mature miRNA
Sequence 54 - UAGCACCAUUUGAAAUCGGUUA - 75
Evidence experimental
cloned [1-4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714