miRBase entry: gma-MIR10405c

Stem-loop gma-MIR10405c


Accession
MI0033466
Description
Glycine max gma-MIR10405c precursor miRNA


Sequence


aucuccugucuuuuuuauaagaaacaaguuuuaguguaaauauacuaaaacUUGUUUCUUAUAAAAAGGACCagagggagua
..(((((((((((((((((((((((((((((((((((....))))))))))))))))))))))))))))))....)))))..

Structure
au     ----                              a 
  cuccu    gucuuuuuuauaagaaacaaguuuuagugu a
  |||||    ||||||||||||||||||||||||||||||  
  gaggg    CAGGAAAAAUAUUCUUUGUUcaaaaucaua a
au     agaC                              u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr8: 40949576-40949657 [-]

Database links

Mature gma-miR10405c

Accession MIMAT0041674
Description Glycine max gma-miR10405c mature miRNA
Sequence 52 - UUGUUUCUUAUAAAAAGGACC - 72
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 25747880
    Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean
    "Zhao M, Meyers BC, Cai C, Xu W, Ma J"
    "Plant Cell (2015) 27:546-562