miRBase entry: gmo-mir-150

Stem-loop gmo-mir-150


Accession
MI0036203
Description
Gadus morhua gmo-mir-150 precursor miRNA


Sequence


UCUCCCAAUCCUUGUACCAGUGUcguggugucggccgacgcugggcaggcuuugggggg
.(((((((..(((((.((((((((..(((....))))))))))))))))..))))))).

Structure
U       UC     A        gu   g 
 CUCCCAA  CUUGU CCAGUGUc  ggu u
 |||||||  ||||| ||||||||  |||  
 ggggguu  ggacg ggucgcag  ccg c
g       uc     -        --   g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
HE566723.1: 314469-314527 [+]

Database links

Mature gmo-miR-150-5p

Accession MIMAT0044310
Description Gadus morhua gmo-miR-150-5p mature miRNA
Sequence 1 - UCUCCCAAUCCUUGUACCAGUGU - 23
Evidence experimental
SOLiD [1], Illumina [2]

References

  1. PubMed ID: 25881242
    Temperature during early development has long-term effects on microRNA expression in Atlantic cod
    Bizuayehu TT, Johansen SD, Puvanendran V, Toften H, Babiak I
    BMC Genomics (2015) 16:305

  2. PubMed ID: 27128807
    Discovery of miRNAs and Their Corresponding miRNA Genes in Atlantic Cod (Gadus morhua): Use of Stable miRNAs as Reference Genes Reveals Subgroups of miRNAs That Are Highly Expressed in Particular Organs
    Andreassen R, Rangnes F, Sivertsen M, Chiang M, Tran M, Worren MM
    PLoS One (2016) 11:e0153324