miRBase entry: xla-let-7a

Stem-loop xla-let-7a


Accession
MI0038219
Description
Xenopus laevis xla-let-7a precursor miRNA

Literature search
2 open access papers mention xla-let-7a
(2 sentences)

Sequence


UGAGGUAGUAGGUUGUAUAGUUgaggauaacaccaaaggagauaaCUGUACAGCCUCCUAUCUUUCC
.(((((((.((((((((((((((.((......))........)))))))))))))).)))))))...

Structure
--U       U              -------a  au 
   GAGGUAG AGGUUGUAUAGUUg        gg  a
   ||||||| ||||||||||||||        ||   
   UUCUAUC UCCGACAUGUCaau        cc  a
CCU       C              agaggaaa  ac 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr7L: 113013226-113013292 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from xla-let-7a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature xla-let-7a-5p

Accession MIMAT0046395
Description Xenopus laevis xla-let-7a-5p mature miRNA
Sequence 1 - UGAGGUAGUAGGUUGUAUAGUU - 22
Evidence experimental
Illumina [1]

Mature xla-let-7a-3p

Accession MIMAT0046396
Description Xenopus laevis xla-let-7a-3p mature miRNA
Sequence 46 - CUGUACAGCCUCCUAUCUUUCC - 67
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38