miRBase entry: xla-let-7b

Stem-loop xla-let-7b


Accession
MI0038220
Description
Xenopus laevis xla-let-7b precursor miRNA

Literature search
2 open access papers mention xla-let-7b
(2 sentences)

Sequence


UGAGGUAGUAGUUUGUGUAGUUagggggcagugguguuugcccauggagauaaCUAGACAAACUACUGCCUUGCC
.(((((((((((((((.((((((..((((((......)))))).......)))))).)))))))))))))))...

Structure
--U               G      -----gg      ug 
   GAGGUAGUAGUUUGU UAGUUa       gggcag  g
   ||||||||||||||| ||||||       ||||||   
   UUCCGUCAUCAAACA AUCaau       cccguu  u
CCG               G      agaggua      ug 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2L: 58268821-58268895 [-]

Database links

Mature xla-let-7b-5p

Accession MIMAT0046397
Description Xenopus laevis xla-let-7b-5p mature miRNA
Sequence 1 - UGAGGUAGUAGUUUGUGUAGUU - 22
Evidence experimental
Illumina [1]

Mature xla-let-7b-3p

Accession MIMAT0046398
Description Xenopus laevis xla-let-7b-3p mature miRNA
Sequence 54 - CUAGACAAACUACUGCCUUGCC - 75
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38