miRBase entry: xla-mir-128-2

Stem-loop xla-mir-128-2


Accession
MI0038242
Description
Xenopus laevis xla-mir-128-2 precursor miRNA

Literature search
1 open access papers mention xla-mir-128-2
(1 sentences)

Sequence


CGGGCCCGGAGCGCUGUCUGAgaggguuuacguuucUCACAGUGAACCGGUCUCUUU
.(((.((((..((((((..((((.(.....).))))..))))))..)))).)))...

Structure
--C   C    AG      CU    g g 
   GGG CCGG  CGCUGU  GAga g u
   ||| ||||  ||||||  |||| | u
   CUC GGCC  GUGACA  cuuu c u
UUU   U    AA      CU    g a 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr9_10S: 48857062-48857118 [+]

Database links

Mature xla-miR-128-2-5p

Accession MIMAT0046438
Description Xenopus laevis xla-miR-128-2-5p mature miRNA
Sequence 1 - CGGGCCCGGAGCGCUGUCUGA - 21
Evidence experimental
Illumina [1]

Mature xla-miR-128-3p

Accession MIMAT0046439
Description Xenopus laevis xla-miR-128-3p mature miRNA
Sequence 37 - UCACAGUGAACCGGUCUCUUU - 57
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38