miRBase entry: xla-mir-135

Stem-loop xla-mir-135


Accession
MI0038248
Description
Xenopus laevis xla-mir-135 precursor miRNA


Sequence


UAUGGCUUUUUAUUCCUAUGUGAUaguaauaaugucuCAUGUAGGGAUGGAAGCCAUGAA
((((((((((.((((((((((((.............))))))))))))))))))))))..

Structure
--          U            Uagua 
  UAUGGCUUUU AUUCCUAUGUGA     a
  |||||||||| ||||||||||||     u
  GUACCGAAGG UAGGGAUGUACu     a
AA          -            cugua 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr3L: 36982438-36982497 [+]

Database links

Mature xla-miR-135-5p

Accession MIMAT0046447
Description Xenopus laevis xla-miR-135-5p mature miRNA
Sequence 1 - UAUGGCUUUUUAUUCCUAUGUGAU - 24
Evidence experimental
Illumina [1]

Mature xla-miR-135-3p

Accession MIMAT0046448
Description Xenopus laevis xla-miR-135-3p mature miRNA
Sequence 38 - CAUGUAGGGAUGGAAGCCAUGAA - 60
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38