miRBase entry: xla-mir-181a

Stem-loop xla-mir-181a


Accession
MI0038269
Description
Xenopus laevis xla-mir-181a precursor miRNA

Literature search
1 open access papers mention xla-mir-181a
(1 sentences)

Sequence


AACAUUCAACGCUGUCGGUGAguuugguaucuaaaggcaaaccAUCGAUCGUUGACUGUACA
.(((.((((((..(((((((.(((((.(.......).)))))))))))))))))).)))...

Structure
--A   U      CU       A     g au 
   ACA UCAACG  GUCGGUG guuug u  c
   ||| ||||||  ||||||| ||||| |  u
   UGU AGUUGC  UAGCUAc caaac g  a
ACA   C      --       -     g aa 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr4S: 74639795-74639856 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from xla-mir-181a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature xla-miR-181a-5p

Accession MIMAT0046485
Description Xenopus laevis xla-miR-181a-5p mature miRNA
Sequence 1 - AACAUUCAACGCUGUCGGUGA - 21
Evidence experimental
Illumina [1]

Mature xla-miR-181a-3p

Accession MIMAT0046486
Description Xenopus laevis xla-miR-181a-3p mature miRNA
Sequence 44 - AUCGAUCGUUGACUGUACA - 62
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38