miRBase entry: xla-mir-210

Stem-loop xla-mir-210


Accession
MI0038294
Description
Xenopus laevis xla-mir-210 precursor miRNA


Sequence


AGCCACUGACUAACGCACAUUGcgcugcugcuaaaaugccaCUGUGCGUGUGACAGCGGCUAA
((((.(((.(..(((((((.((.((............)))).)))))))..).))).))))..

Structure
--    A   A UA       U  c  ugcug 
  AGCC CUG C  ACGCACA UG gc     c
  |||| ||| |  ||||||| || ||      
  UCGG GAC G  UGCGUGU ac cg     u
AA    C   A UG       C  -  uaaaa 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr4L: 22477271-22477333 [-]

Database links

Mature xla-miR-210-5p

Accession MIMAT0046530
Description Xenopus laevis xla-miR-210-5p mature miRNA
Sequence 1 - AGCCACUGACUAACGCACAUUG - 22
Evidence experimental
Illumina [1]

Mature xla-miR-210-3p

Accession MIMAT0046531
Description Xenopus laevis xla-miR-210-3p mature miRNA
Sequence 42 - CUGUGCGUGUGACAGCGGCUAA - 63
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38