miRBase entry: xla-mir-24a-2

Stem-loop xla-mir-24a-2


Accession
MI0038305
Description
Xenopus laevis xla-mir-24a-2 precursor miRNA


Sequence


GUGCCUACUGAACUGAUAUCAGUucuauuucauacacUGGCUCAGUUCAGCAGGAACAG
((.(((.(((((((((..(((((............))))).))))))))).))).))..

Structure
--  G   A         UA     ucuau 
  GU CCU CUGAACUGA  UCAGU     u
  || ||| |||||||||  |||||      
  CA GGA GACUUGACU  GGUca     u
GA  A   C         -C     cauac 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr1L: 125599057-125599115 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from xla-mir-24a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature xla-miR-24a-5p

Accession MIMAT0046550
Description Xenopus laevis xla-miR-24a-5p mature miRNA
Sequence 1 - GUGCCUACUGAACUGAUAUCAGU - 23
Evidence experimental
Illumina [1]

Mature xla-miR-24a-3p

Accession MIMAT0046551
Description Xenopus laevis xla-miR-24a-3p mature miRNA
Sequence 38 - UGGCUCAGUUCAGCAGGAACAG - 59
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38