miRBase entry: xla-mir-29b

Stem-loop xla-mir-29b


Accession
MI0038313
Description
Xenopus laevis xla-mir-29b precursor miRNA


Sequence


AGCUGGUUUCAUAUGGUGACUUAGAuuuauccaucucuguuucUAGCACCAUUUGAAAUCAGUGUU
.((((((((((.((((((.((.(((................))))))))))).))))))))))...

Structure
--A          U      A  U   uuuaucc 
   GCUGGUUUCA AUGGUG CU AGA       a
   |||||||||| |||||| || |||        
   UGACUAAAGU UACCAC GA Ucu       u
UUG          U      -  -   uugucuc 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2L: 47230337-47230402 [+]

Database links

Mature xla-miR-29b-5p

Accession MIMAT0046562
Description Xenopus laevis xla-miR-29b-5p mature miRNA
Sequence 1 - AGCUGGUUUCAUAUGGUGACUUAGA - 25
Evidence experimental
Illumina [1]

Mature xla-miR-29b-3p

Accession MIMAT0046563
Description Xenopus laevis xla-miR-29b-3p mature miRNA
Sequence 44 - UAGCACCAUUUGAAAUCAGUGUU - 66
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38