miRBase entry: xla-mir-29c

Stem-loop xla-mir-29c


Accession
MI0038314
Description
Xenopus laevis xla-mir-29c precursor miRNA


Sequence


ACCGAUCUCUCUUGGUGUUCAGaggcucaggucuucaucUAGCACCAUUUGAAAUCGGUUA
((((((.((...(((((((..(((((....))))).....)))))))...)).))))))..

Structure
--      C  UCU       ---CA     u 
  ACCGAU UC   UGGUGUU     Gaggc c
  |||||| ||   |||||||     |||||  
  UGGCUA AG   ACCACGA     uucug a
AU      A  UUU       Ucuac     g 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2S: 40460714-40460774 [+]

Database links

Mature xla-miR-29c-5p

Accession MIMAT0046564
Description Xenopus laevis xla-miR-29c-5p mature miRNA
Sequence 1 - ACCGAUCUCUCUUGGUGUUCAG - 22
Evidence experimental
Illumina [1]

Mature xla-miR-29c-3p

Accession MIMAT0046565
Description Xenopus laevis xla-miR-29c-3p mature miRNA
Sequence 40 - UAGCACCAUUUGAAAUCGGUUA - 61
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38