miRBase entry: xla-mir-30d

Stem-loop xla-mir-30d


Accession
MI0038320
Description
Xenopus laevis xla-mir-30d precursor miRNA

Literature search
1 open access papers mention xla-mir-30d
(1 sentences)

Sequence


UGUAAACAUCCCCGACUGGAAGCUgugaggcugcaccuuagCUUUCAGUCUGGUGUUUGCUGC
.(((((((((...(((((((((((..((((.....))))))))))))))).)))))))))...

Structure
--U         CCC           gu    c 
   GUAAACAUC   GACUGGAAGCU  gagg u
   |||||||||   |||||||||||  |||| g
   CGUUUGUGG   CUGACUUUCga  uucc c
CGU         --U           --    a 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr6L: 116315785-116315847 [-]

Database links

Mature xla-miR-30d-5p

Accession MIMAT0046574
Description Xenopus laevis xla-miR-30d-5p mature miRNA
Sequence 1 - UGUAAACAUCCCCGACUGGAAGCU - 24
Evidence experimental
Illumina [1]

Mature xla-miR-30d-3p

Accession MIMAT0046575
Description Xenopus laevis xla-miR-30d-3p mature miRNA
Sequence 42 - CUUUCAGUCUGGUGUUUGCUGC - 63
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26548531
    Identification of microRNAs and microRNA targets in Xenopus gastrulae: The role of miR-26 in the regulation of Smad1
    "Liu C, Lou CH, Shah V, Ritter R, Talley J, Soibam B, Benham A, Zhu H, Perez E, Shieh YE, Gunaratne PH, Sater AK"
    "Dev Biol (2016) 409:26-38