miRBase entry: bta-mir-299-2

Stem-loop bta-mir-299-2


Accession
MI0038394
Description
Bos taurus bta-mir-299-2 precursor miRNA


Sequence

8 reads, 1 reads per million, 8 experiments
cgguuuaccgucccacauacauauucagaauGUAUGUGGGACGGUAAACCAU
.(((((((((((((((((((((.......)))))))))))))))))))))..

Structure
-c                     au 
  gguuuaccgucccacauacau  u
  |||||||||||||||||||||  c
  CCAAAUGGCAGGGUGUAUGua  a
UA                     ag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr21: 67841948-67841999 [-]
Clustered miRNAs
14 other miRNAs are < 10 kb from bta-mir-299-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-299-2

Accession MIMAT0046669
Description Bos taurus bta-miR-299-2 mature miRNA
Sequence 32 - GUAUGUGGGACGGUAAACCAU - 52
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26519053
    Deep sequencing shows microRNA involvement in bovine mammary gland adaptation to diets supplemented with linseed oil or safflower oil
    Li R, Beaudoin F, Ammah AA, Bissonnette N, Benchaar C, Zhao X, Lei C, Ibeagha-Awemu EM
    BMC Genomics (2015) 16:884