Mature dme-miR-316-3p
| Accession | MIMAT0020842 |
| Description | dme-miR-316-3p mature miRNA |
| Hairpins | |
| Sequence | ACAGGAAAGGGAAAAAGGCGUA |
| Evidence | not_experimental |
| Database links |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0034587 piRNA processing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:37467338 |
