Accession | MIMAT0000063 |
Description | hsa-let-7b-5p mature miRNA |
Hairpins | |
Sequence | UGAGGUAGUAGGUUGUGUGGUU |
Evidence |
experimental
cloned [1,3-5], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24978044 | occurs_in CL:1001568 |
acts_upstream_of | GO:0045766 positive regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28159509 | occurs_in CL:0000071 |
acts_upstream_of | GO:1903589 positive regulation of blood vessel endothelial cell proliferation involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28159509 | |
acts_upstream_of | GO:1904753 negative regulation of vascular associated smooth muscle cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24978044 | occurs_in CL:0002591 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15131085 | has_input UniProtKB:Q9H9Z2 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24978044 | has_input UniProtKB:P36897 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | has_input UniProtKB:P42574 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27809873 | has_input UniProtKB:P05231 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29471394 | has_input UniProtKB:P25445 |
involved_in | GO:0010507 negative regulation of autophagy |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | |
involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24978044 | has_input UniProtKB:P36897 |
involved_in | GO:0034614 cellular response to reactive oxygen species |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15131085 | has_input UniProtKB:Q9H9Z2 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24978044 | has_input UniProtKB:P36897 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | has_input UniProtKB:P42574 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27809873 | has_input UniProtKB:P05231 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28159509 | has_input UniProtKB:P36897 |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29471394 | has_input UniProtKB:P25445 |
involved_in | GO:0043154 negative regulation of cysteine-type endopeptidase activity involved in apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | has_input UniProtKB:P42574 |
involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | occurs_in UBERON:0002349 |
involved_in | GO:0070374 positive regulation of ERK1 and ERK2 cascade |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | |
involved_in | GO:0140367 antibacterial innate immune response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29471394 | occurs_in CL:0000235 |
involved_in | GO:1901299 negative regulation of hydrogen peroxide-mediated programmed cell death |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26296645 | occurs_in CL:0002540 |
involved_in | GO:1903845 negative regulation of cellular response to transforming growth factor beta stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24978044 | has_input UniProtKB:P01137 |
involved_in | GO:2000110 negative regulation of macrophage apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29471394 | occurs_in CL:0000235 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|