Accession | MIMAT0000070 |
Description | hsa-miR-17-5p mature miRNA |
Hairpins | |
Sequence | CAAAGUGCUUACAGUGCAGGUAG |
Evidence |
experimental
cloned [2,5-8], Northern [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P06858 |
acts_upstream_of | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P15090 |
acts_upstream_of | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P37231 |
acts_upstream_of | GO:0010628 positive regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P49715 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:Q13950 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:Q8TDD2 |
acts_upstream_of_or_within | GO:0045600 positive regulation of fat cell differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23399447 | occurs_in CL:0002570 |
acts_upstream_of_or_within | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23399447 | occurs_in CL:0002570 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21982160 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P12643 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24378993 | has_input UniProtKB:Q13873 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25785043 | has_input UniProtKB:O95477 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19390056 | has_input UniProtKB:Q13873 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20190813 | has_input UniProtKB:P38936 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20299512 | has_input UniProtKB:P23458 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21067317 | has_input UniProtKB:Q13562 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21145484 | has_input UniProtKB:P37173 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:21982160 | has_input UniProtKB:P05067 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22473208 | has_input UniProtKB:Q6IMN6 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23059786 | has_input UniProtKB:P38936 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23285084 | has_input UniProtKB:P01130 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23285084 | has_input UniProtKB:Q9BYX2 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23399447 | has_input UniProtKB:P12643 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23562609 | has_input UniProtKB:P78324 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|