miRBase entry: hsa-mir-17

Stem-loop hsa-mir-17


Accession
MI0000071
Symbol
HGNC: MIR17
Description
Homo sapiens hsa-mir-17 precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR17 is a microRNA that plays a significant role in the regulation of gene expression, impacting various biological processes [PMC8627999]. Research has demonstrated the potential of grapefruit-derived nanovectors to deliver therapeutic MIR17 to the brain, indicating a novel approach for treatment strategies [PMC8067521]. In plant studies, MIR17's importance is underscored by observations that double-knockdown lines involving MIR17 exhibit notable reductions in shoot surface area, suggesting its role in shoot growth regulation [PMC8528425]. However, while MIR17 is implicated in the control of STAT3 levels, it is not directly associated with the control of NF-KB1; instead, it is part of a complex gene regulatory network that includes other microRNAs and regulatory proteins such as BRCA1, which are involved in the regulation of STAT3 [PMC8627999].

Literature search
1898 open access papers mention hsa-mir-17
(8068 sentences)

Sequence

2292378 reads, 6501.0 reads per million, 187 experiments
gucagaauaauguCAAAGUGCUUACAGUGCAGGUAGugauaugugcaucuACUGCAGUGAAGGCACUUGUAGcauuauggugac
((((..(((((((..((((((((.((.(((((.(((((.......)).)))))))).)).))))))))...)))))))..))))

Structure
    ga       -CA        A  G     G   -  au 
guca  auaaugu   AAGUGCUU CA UGCAG UAG ug  a
||||  |||||||   |||||||| || ||||| ||| ||  u
cagu  uauuacG   UUCACGGA GU ACGUC Auc ac  g
    gg       AUG        A  G     -   u  gu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr13: 91350605-91350688 [+]
Clustered miRNAs
5 other miRNAs are < 10 kb from hsa-mir-17
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-17 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-17 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-17 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-17-5p

Accession MIMAT0000070
Description Homo sapiens hsa-miR-17-5p mature miRNA
Sequence 14 - CAAAGUGCUUACAGUGCAGGUAG - 36
Evidence experimental
cloned [2,5-8], Northern [4]
Database links
Predicted targets

Mature hsa-miR-17-3p

Accession MIMAT0000071
Description Homo sapiens hsa-miR-17-3p mature miRNA
Sequence 51 - ACUGCAGUGAAGGCACUUGUAG - 72
Evidence experimental
cloned [1,5,7-8], Northern [1]
Database links
Predicted targets

References

  1. PubMed ID: 11679670
    Identification of novel genes coding for small expressed RNAs
    "Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T"
    "Science (2001) 294:853-858

  2. PubMed ID: 15183728
    Human embryonic stem cells express a unique set of microRNAs
    "Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, Cha KY, Chung HM, Yoon HS, Moon SY, Kim VN, Kim KS"
    "Dev Biol (2004) 270:488-498

  3. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  4. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  5. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  6. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  7. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  8. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854