Mature hsa-miR-17-3p
| Accession | MIMAT0000071 |
| Description | hsa-miR-17-3p mature miRNA |
| Hairpins | |
| Sequence | ACUGCAGUGAAGGCACUUGUAG |
| Evidence |
experimental
cloned [1,5,7-8], Northern [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0048146 positive regulation of fibroblast proliferation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002548 |
| involved_in | GO:1901299 negative regulation of hydrogen peroxide-mediated programmed cell death |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002548 |
| involved_in | GO:2000773 negative regulation of cellular senescence |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:0002548 |
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
