Accession | MIMAT0000083 |
Description | hsa-miR-26b-5p mature miRNA |
Hairpins | |
Sequence | UUCAAGUAAUUCAGGAUAGGU |
Evidence |
experimental
cloned [1,3-5], Northern [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0032682 negative regulation of chemokine production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26222045 | occurs_in CL:2000001 |
acts_upstream_of | GO:0032688 negative regulation of interferon-beta production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26222045 | occurs_in CL:2000001 |
acts_upstream_of_negative_effect | GO:0051607 defense response to virus |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26222045 | occurs_in CL:2000001 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24027266 | has_input UniProtKB:P06400 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26222045 | has_input UniProtKB:O00206 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27027434 | has_input UniProtKB:Q15797 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24027266 | has_input UniProtKB:P06400 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26222045 | has_input UniProtKB:O00206 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27027434 | has_input UniProtKB:Q15797 |
involved_in | GO:0045787 positive regulation of cell cycle |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:24027266 | has_input UniProtKB:P39949 |
involved_in | GO:0050687 negative regulation of defense response to virus |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26222045 | occurs_in CL:2000001 |
involved_in | GO:0060392 negative regulation of SMAD protein signal transduction |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27027434 | occurs_in UBERON:0002107 |
involved_in | GO:0071902 positive regulation of protein serine/threonine kinase activity |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:24027266 | occurs_in CL:0010012 |
involved_in | GO:1902949 positive regulation of tau-protein kinase activity |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:24027266 | occurs_in CL:0010012 |
involved_in | GO:2001235 positive regulation of apoptotic signaling pathway |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:24027266 | has_input UniProtKB:Q9JHX4 |
located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|