Accession | MIMAT0000093 |
Description | hsa-miR-93-5p mature miRNA |
Hairpins | |
Sequence | CAAAGUGCUGUUCGUGCAGGUAG |
Evidence |
experimental
cloned [1,3-6], Northern [4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0008285 negative regulation of cell population proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26175939 | occurs_in CL:0002255 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:P29279 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:Q8NC51 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28797104 | has_input UniProtKB:Q13950 |
acts_upstream_of | GO:0010880 regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25389315 | occurs_in CL:0000746 |
acts_upstream_of | GO:0030336 negative regulation of cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26175939 | occurs_in CL:0002255 |
acts_upstream_of | GO:0030514 negative regulation of BMP signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28797104 | |
acts_upstream_of | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | occurs_in CL:0002366 |
acts_upstream_of | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24433094 | occurs_in CL:0002328 |
acts_upstream_of | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28797104 | occurs_in CL:2000079 |
acts_upstream_of | GO:0050709 negative regulation of protein secretion |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26986724 | has_input UniProtKB:P15692 |
acts_upstream_of | GO:2000648 positive regulation of stem cell proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28797104 | occurs_in CL:2000079 |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:P00749 |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:P26022 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:P10145 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:P13726 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25389315 | has_input UniProtKB:Q92736 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25785043 | has_input UniProtKB:O95477 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28797104 | has_input UniProtKB:P12643 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18728182 | has_input UniProtKB:Q92831 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20190813 | has_input UniProtKB:P38936 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:P10145 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22556343 | has_input UniProtKB:P13726 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23285084 | has_input UniProtKB:P01130 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|