miRBase entry: hsa-mir-93

Stem-loop hsa-mir-93


Accession
MI0000095
Symbol
HGNC: MIR93
Description
Homo sapiens hsa-mir-93 precursor miRNA mir-17
Gene
family?
RF00051; mir-17

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR93 is a microRNA that, intriguingly, has been observed to have upregulated expression levels despite possessing strongly hypermethylated promoters [PMC4198682]. This upregulation is notable as hypermethylation in promoter regions is typically associated with gene silencing [PMC4198682]. MIR93, along with miR191, has also been the subject of research in the context of medical health issues [PMC7430915]. Specifically, it was included in a logistic regression analysis to ascertain its potential as a predictive marker for abnormal CT findings in patients with malignant hyperthermia susceptibility (MHT) [PMC7430915]. This suggests that MIR93 may have diagnostic value and could contribute to the understanding and management of MHT [PMC7430915].

Literature search
297 open access papers mention hsa-mir-93
(1900 sentences)

Sequence

429911 reads, 1906 reads per million, 154 experiments
cugggggcucCAAAGUGCUGUUCGUGCAGGUAGugugauuacccaaccuACUGCUGAGCUAGCACUUCCCGagcccccgg
((((((((((..((((((((((((.((((.(((.((.........)))))))))))))).)))))))...))))))))))

Structure
          -CA       -     U    G   u  gau 
cugggggcuc   AAGUGCU GUUCG GCAG UAG gu   u
||||||||||   ||||||| ||||| |||| ||| ||   a
ggcccccgaG   UUCACGA CGAGU CGUC Auc ca   c
          CCC       U     -    -   -  acc 


Annotation confidence High
Do you think this miRNA is real?
Comments
Mourelatos et al. identified two copies of this sequence mapping to chromosome 7, and assigned the names mir-93-7.1 and mir-93-7.2 [1]. Subsequent genome assemblies suggest the presence of only one miR-93 locus on chromosome 7. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr7: 100093768-100093847 [-]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-93
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-93 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-93 is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-93 is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-93-5p

Accession MIMAT0000093
Description Homo sapiens hsa-miR-93-5p mature miRNA
Sequence 11 - CAAAGUGCUGUUCGUGCAGGUAG - 33
Evidence experimental
cloned [1,3-6], Northern [4]
Database links
Predicted targets

Mature hsa-miR-93-3p

Accession MIMAT0004509
Description Homo sapiens hsa-miR-93-3p mature miRNA
Sequence 50 - ACUGCUGAGCUAGCACUUCCCG - 71
Evidence experimental
cloned [5]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 15325244
    Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells
    "Kasashima K, Nakamura Y, Kozu T"
    "Biochem Biophys Res Commun (2004) 322:403-410

  3. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  4. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  5. PubMed ID: 11914277
    miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs
    "Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G"
    "Genes Dev (2002) 16:720-728

  6. PubMed ID: 15978578
    Identification of human fetal liver miRNAs by a novel method
    "Fu H, Tie Y, Xu C, Zhang Z, Zhu J, Shi Y, Jiang H, Sun Z, Zheng X"
    "FEBS Lett (2005) 579:3849-3854