WARNING: This summary was generated by AI. MIR93 is a microRNA that, intriguingly, has been observed to have upregulated expression levels despite possessing strongly hypermethylated promoters [PMC4198682]. This upregulation is notable as hypermethylation in promoter regions is typically associated with gene silencing [PMC4198682]. MIR93, along with miR191, has also been the subject of research in the context of medical health issues [PMC7430915]. Specifically, it was included in a logistic regression analysis to ascertain its potential as a predictive marker for abnormal CT findings in patients with malignant hyperthermia susceptibility (MHT) [PMC7430915]. This suggests that MIR93 may have diagnostic value and could contribute to the understanding and management of MHT [PMC7430915].
-CA - U G u gau
cugggggcuc AAGUGCU GUUCG GCAG UAG gu u
|||||||||| ||||||| ||||| |||| ||| || a
ggcccccgaG UUCACGA CGAGU CGUC Auc ca c
CCC U - - - acc
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000093 |
| Description | Homo sapiens hsa-miR-93-5p mature miRNA |
| Sequence | 11 - CAAAGUGCUGUUCGUGCAGGUAG - 33 |
| Evidence |
experimental
cloned [1,3-6], Northern [4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004509 |
| Description | Homo sapiens hsa-miR-93-3p mature miRNA |
| Sequence | 50 - ACUGCUGAGCUAGCACUUCCCG - 71 |
| Evidence |
experimental
cloned [5] |
| Database links |
|
| Predicted targets |
|
|