Mature mmu-miR-125a-5p
| Accession | MIMAT0000135 |
| Description | mmu-miR-125a-5p mature miRNA |
| Hairpins | |
| Sequence | UCCCUGAGACCCUUUAACCUGUGA |
| Evidence |
experimental
cloned [1-2], Illumina [3-4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0001960 negative regulation of cytokine-mediated signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30089723 | has_input UniProtKB:O54824-PRO_0000015418 |
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30089723 | has_input UniProtKB:P17515 |
| acts_upstream_of | GO:0032682 negative regulation of chemokine production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30089723 | has_input UniProtKB:P17515 |
| acts_upstream_of | GO:1902564 negative regulation of neutrophil activation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30089723 | occurs_in UBERON:0002048 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25059272 | has_input UniProtKB:A0A0R4IZY5 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25059272 | has_input UniProtKB:Q00731 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25059272 | occurs_in CL:0000115 |
| involved_in | GO:0032699 negative regulation of interleukin-16 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30089723 | occurs_in UBERON:0002048 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30089723 | has_input UniProtKB:O54824 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25059272 | has_input UniProtKB:A0A0R4IZY5 |
| involved_in | GO:1900016 negative regulation of cytokine production involved in inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30089723 | has_input UniProtKB:O54824-PRO_0000015418 |
| involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25059272 | occurs_in CL:0000115 |
