Mature mmu-miR-146a-5p
| Accession | MIMAT0000158 |
| Description | mmu-miR-146a-5p mature miRNA |
| Hairpins | |
| Sequence | UGAGAACUGAAUUCCAUGGGUU |
| Evidence |
experimental
cloned [1-2], Illumina [3-4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27908889 | has_input UniProtKB:P53351 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27908889 | has_input UniProtKB:P53351 |
| involved_in | GO:0071222 cellular response to lipopolysaccharide |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28096568 | occurs_in CL:0000129 |
| involved_in | GO:0090051 negative regulation of cell migration involved in sprouting angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27908889 | occurs_in CL:0002619 |
| involved_in | GO:0120132 positive regulation of apoptotic process in bone marrow cell |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27908889 | occurs_in CL:0002619 |
| involved_in | GO:2000774 positive regulation of cellular senescence |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27908889 | occurs_in CL:0002619 |
| located_in | GO:0005615 extracellular space |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27908889 | part_of CL:0002619 |
| located_in | GO:0070062 extracellular exosome |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28096568 | produced_by CL:0000129 |
