Accession | MIMAT0000208 |
Description | mmu-miR-10b-5p mature miRNA |
Hairpins | |
Sequence | UACCCUGUAGAACCGAAUUUGUG |
Evidence |
experimental
cloned [1-2], Illumina [3-4] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24804980 | has_input UniProtKB:P21237 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24804980 | has_input UniProtKB:P21237 |