Comments or questions? Email
mirbase@manchester.ac.uk
| Accession | MIMAT0000251 |
| Description | hsa-miR-147a mature miRNA |
| Hairpins | |
| Sequence | GUGUGUGGAAAUGCUUCUGC |
| Evidence | not_experimental |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|