Accession | MIMAT0000255 |
Description | hsa-miR-34a-5p mature miRNA |
Hairpins | |
Sequence | UGGCAGUGUCUUAGCUGGUUGU |
Evidence |
experimental
cloned [2-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010884 positive regulation of lipid storage |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26330104 | occurs_in CL:0000182 |
acts_upstream_of | GO:0034763 negative regulation of transmembrane transport |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28073349 | |
acts_upstream_of | GO:0071901 negative regulation of protein serine/threonine kinase activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:Q13131 |
acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:Q96EB6 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24637697 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24637697 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25355491 | has_input UniProtKB:Q12809 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:Q07869 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28073349 | has_input UniProtKB:P30556 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33229509 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33229509 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33229509 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33229509 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33229509 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:33229509 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23426265 | has_input UniProtKB:Q96QC0 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23462268 | has_input UniProtKB:Q9NZC2 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24637697 | has_input UniProtKB:P18206 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24637697 | has_input UniProtKB:Q14318 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24792364 | has_input UniProtKB:Q9P0K8 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25355491 | has_input UniProtKB:Q12809 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26330104 | has_input UniProtKB:Q07869 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26949937 | has_input UniProtKB:Q9NZC2 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27302634 | has_input UniProtKB:P16234 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|