MIR34A is found to be downregulated in gastric cancer cell lines, such as BGC-823, compared to normal gastric epithelium cell lines [PMC4650715]. It has been suggested that MYCN downregulates MIR34A, similar to the action of c-Myc in colon carcinoma cells [PMC6048510]. MIR34A upregulation in T cells may explain the increased induction and activated state of T cells [PMC5351619]. The expression patterns of mature MIR34A differ from pri-MIR34A in METTL3-knockdown and METTL3-overexpressing cells [PMC7347714]. MIR34A is needed to repress Lef-1 post-transcriptionally along with miR-223 [PMC6282069]. The head-to-head orientation of the MIR34A HG and lncTAM34a allows for direct binding and targeting by sequence complementarity between the RNA and promoter DNA [PMC6030072]. Disruption of both TP53 and MIR34A is associated with poor survival in cancer patients [PMC4039115]. MIR34A negatively regulates dendrite outgrowth, while miR-124 positively regulates axonal and dendritic branching [PMC5928558]. The regulation of MHC-I by MIR34A in hippocampal neurons still needs further investigation [PMC7655649]. Co-administration of MIR34A with Dox inhibits invasion and migration in breast cancer cells [PMC8463267]..\
- -a -- - uU - A -guga a ggcc gc ugug aguguuucu GGCAGUGU CUU GCUGGUUGUu gc a |||| || |||| ||||||||| |||||||| ||| |||||||||| || ccgg ug gcac ucgugaaga CCGUCAUA GAA CGACUAACga ug u c gg uu g UC U - aggaa a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000255 |
Description | Homo sapiens hsa-miR-34a-5p mature miRNA |
Sequence | 22 - UGGCAGUGUCUUAGCUGGUUGU - 43 |
Evidence |
experimental
cloned [2-4] |
Database links | |
Predicted targets |
Accession | MIMAT0004557 |
Description | Homo sapiens hsa-miR-34a-3p mature miRNA |
Sequence | 64 - CAAUCAGCAAGUAUACUGCCCU - 85 |
Evidence |
experimental
cloned [3] |
Database links | |
Predicted targets |
|