WARNING: This summary was generated by AI. MIR34A is a microRNA implicated in various cellular processes and diseases, including cancer [PMC4650715]. In gastric cancer cell lines, BGC-823 showed a notable downregulation of MIR34A compared to the normal gastric epithelium [PMC4650715]. This microRNA is involved in the regulation of genes such as MYCN and ZNF281, and its downregulation is similar to the effects observed with c-Myc in colon carcinoma cells [PMC6048510]. MIR34A also plays a role in the immune system, where its upregulation may contribute to T cell activation and induction in autoimmune diseases [PMC5351619]. In addition, it has been observed that MIR34A can regulate gene expression post-transcriptionally by targeting Lef-1 with the help of miR-223 [PMC6282069]. The expression patterns of mature MIR34A are inversely related to those of pri-MIR34A when METTL3 expression is manipulated [PMC7347714]. Furthermore, disruptions involving both TP53 and MIR34A are associated with extremely poor survival outcomes in certain cancers [PMC4039115], while its overexpression has been linked to reduced dendrite outgrowth [PMC5928558]. Collectively, these findings underscore the multifaceted role of MIR34A as a critical regulator in both oncogenic processes and immune responses.
- -a -- - uU - A -guga a ggcc gc ugug aguguuucu GGCAGUGU CUU GCUGGUUGUu gc a |||| || |||| ||||||||| |||||||| ||| |||||||||| || ccgg ug gcac ucgugaaga CCGUCAUA GAA CGACUAACga ug u c gg uu g UC U - aggaa a
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000255 |
| Description | Homo sapiens hsa-miR-34a-5p mature miRNA |
| Sequence | 22 - UGGCAGUGUCUUAGCUGGUUGU - 43 |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004557 |
| Description | Homo sapiens hsa-miR-34a-3p mature miRNA |
| Sequence | 64 - CAAUCAGCAAGUAUACUGCCCU - 85 |
| Evidence |
experimental
cloned [3] |
| Database links |
|
| Predicted targets |
|
|