miRBase entry: hsa-mir-34a

Stem-loop hsa-mir-34a


Accession
MI0000268
Symbol
HGNC: MIR34A
Description
Homo sapiens hsa-mir-34a precursor miRNA mir-34
Gene
family?
RF00456; mir-34

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR34A is a microRNA implicated in various cellular processes and diseases, including cancer [PMC4650715]. In gastric cancer cell lines, BGC-823 showed a notable downregulation of MIR34A compared to the normal gastric epithelium [PMC4650715]. This microRNA is involved in the regulation of genes such as MYCN and ZNF281, and its downregulation is similar to the effects observed with c-Myc in colon carcinoma cells [PMC6048510]. MIR34A also plays a role in the immune system, where its upregulation may contribute to T cell activation and induction in autoimmune diseases [PMC5351619]. In addition, it has been observed that MIR34A can regulate gene expression post-transcriptionally by targeting Lef-1 with the help of miR-223 [PMC6282069]. The expression patterns of mature MIR34A are inversely related to those of pri-MIR34A when METTL3 expression is manipulated [PMC7347714]. Furthermore, disruptions involving both TP53 and MIR34A are associated with extremely poor survival outcomes in certain cancers [PMC4039115], while its overexpression has been linked to reduced dendrite outgrowth [PMC5928558]. Collectively, these findings underscore the multifaceted role of MIR34A as a critical regulator in both oncogenic processes and immune responses.

Literature search
927 open access papers mention hsa-mir-34a
(9143 sentences)

Sequence

47919 reads, 170 reads per million, 147 experiments
ggccagcugugaguguuucuuUGGCAGUGUCUUAGCUGGUUGUugugagcaauaguaaggaagCAAUCAGCAAGUAUACUGCCCUagaagugcugcacguuguggggccc
((((.(((((((((((((((..(((((((((((.((((((((((....((....)).....))))))))))))).))))))))..))))))))).))))..))..)))).

Structure
-    -a  --    -         uU        -   A          -guga  a 
 ggcc  gc  ugug aguguuucu  GGCAGUGU CUU GCUGGUUGUu     gc a
 ||||  ||  |||| |||||||||  |||||||| ||| ||||||||||     ||  
 ccgg  ug  gcac ucgugaaga  CCGUCAUA GAA CGACUAACga     ug u
c    gg  uu    g         UC        U   -          aggaa  a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Dostie et al. independently cloned this sequence in human but misnamed the sequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis) [2]. The sequence maps to human chromosome 1. Human miR-34a was previously named miR-34 here and in [1], but is renamed to clarify homology with the alternatively named mouse sequence (MIR:MI0000584). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr1: 9151668-9151777 [-]

Disease association
hsa-mir-34a is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID

Biological pathways
hsa-mir-34a is involved in one or more biological pathways:
(Source: Reactome)
Biological reactions
hsa-mir-34a is involved in one or more regulation/signalling events:
(Source: Reactome)

Database links

Mature hsa-miR-34a-5p

Accession MIMAT0000255
Description Homo sapiens hsa-miR-34a-5p mature miRNA
Sequence 22 - UGGCAGUGUCUUAGCUGGUUGU - 43
Evidence experimental
cloned [2-4]
Database links
Predicted targets

Mature hsa-miR-34a-3p

Accession MIMAT0004557
Description Homo sapiens hsa-miR-34a-3p mature miRNA
Sequence 64 - CAAUCAGCAAGUAUACUGCCCU - 85
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 12554860
    Numerous microRNPs in neuronal cells containing novel microRNAs
    "Dostie J, Mourelatos Z, Yang M, Sharma A, Dreyfuss G"
    "RNA (2003) 9:180-186

  2. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  3. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  4. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540