Mature hsa-miR-212-3p
| Accession | MIMAT0000269 |
| Description | hsa-miR-212-3p mature miRNA |
| Hairpins | |
| Sequence | UAACAGUCUCCAGUCACGGCC |
| Evidence | not_experimental |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26693054 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22880819 | has_input UniProtKB:P63252 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:Q13480 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26693054 | has_input UniProtKB:P49023 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | has_input UniProtKB:P29475 |
| involved_in | GO:0007179 transforming growth factor beta receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25217442 | |
| involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:Q02297 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:P36382 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:P49765 |
| involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | occurs_in CL:0002618 |
| involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26693054 | |
| involved_in | GO:0033137 negative regulation of peptidyl-serine phosphorylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | has_input UniProtKB:P10636 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:Q13480 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:Q9NXD2 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | has_input UniProtKB:P29475 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22880819 | has_input UniProtKB:P63252 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26693054 | has_input UniProtKB:P49023 |
| involved_in | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25217442 | |
| involved_in | GO:0045019 negative regulation of nitric oxide biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | occurs_in CL:0000540 |
| involved_in | GO:0045747 positive regulation of Notch signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | |
| involved_in | GO:1902083 negative regulation of peptidyl-cysteine S-nitrosylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | occurs_in CL:0000540 |
| involved_in | GO:1903609 negative regulation of inward rectifier potassium channel activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22880819 | |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
