Accession | MIMAT0000274 |
Description | hsa-miR-217-5p mature miRNA |
Hairpins | |
Sequence | UACUGCAUCAGGAACUGAUUGGA |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19786632 | has_input UniProtKB:Q96EB6 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28642131 | has_input UniProtKB:P05231 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30720199 | has_input UniProtKB:Q9UI36 |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19786632 | occurs_in CL:0000071 |
involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28642131 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19786632 | has_input UniProtKB:Q96EB6 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28642131 | has_input UniProtKB:P05231 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30720199 | |
involved_in | GO:1901985 positive regulation of protein acetylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19786632 | occurs_in CL:0000071 |
involved_in | GO:2000774 positive regulation of cellular senescence |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19786632 | occurs_in CL:0000071 |
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|