miRBase entry: hsa-mir-217

Stem-loop hsa-mir-217


Accession
MI0000293
Symbol
HGNC: MIR217
Description
Homo sapiens hsa-mir-217 precursor miRNA mir-217
Gene
family?
RF00673; mir-217

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR217 is a microRNA that has been observed to have varying expression levels in different biological contexts and disease states. In kidney renal papillary cell carcinoma (KIRP), MIR217, along with IGF2BP3 and NCAPG, showed higher expression in type 2 compared to type 1, suggesting a potential role in tumor differentiation or progression [PMC7744790]. In cancer studies, MIR217 has been implicated in the suppression of pulmonary metastasis when expressed in 6DT1 cells, although it did not significantly affect the primary tumor growth [PMC3912413]. Furthermore, MIR217 is known to downregulate SIRT1 mRNA and protein levels, which may contribute to vascular endothelial aging by weakening the antioxidant capacity [PMC9513221]. The interactions of MIR217 with other cellular components have been explored; for instance, its relationship with LINC01268 and SOS1 was investigated to understand its effects on cell viability, cycle progression, and apoptosis in acute myeloid leukemia (AML) cells [PMC7326380]. Additionally, MIR217 is known to interact with long non-coding RNA MALAT1 which can affect the regulatory interactions between miRNAs and mRNAs [PMC6351443]. In inflammatory conditions induced by TNBS (2,4,6-trinitrobenzenesulfonic acid), the expression of MIR217 was significantly downregulated; however, this effect was reversed by BEY-treatment which upregulated its expression [PMC9101272].

Literature search
100 open access papers mention hsa-mir-217
(638 sentences)

Sequence

8798 reads, 248 reads per million, 44 experiments
aguauaauuauuacauaguuuuugaugucgcagaUACUGCAUCAGGAACUGAUUGGAuaagaaucagucacCAUCAGUUCCUAAUGCAUUGCCuucagcaucuaaacaag
.(((.......)))...((((..(((((.(.((.((.(((((.((((((((((.((((........))).).)))))))))).))))).)).)).).))))).))))...

Structure
aguauaauuauuacaua    uu     c c  a  C     C          U -   aag 
                 guuu  gaugu g ag UA UGCAU AGGAACUGAU G GAu   a
                 ||||  ||||| | || || ||||| |||||||||| | |||    
                 caaa  cuacg c uC GU ACGUA UCCUUGACUA c cug   a
--------------gaa    -u     a u  C  U     A          C a   acu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 55982967-55983076 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-217
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-217 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-217-5p

Accession MIMAT0000274
Description Homo sapiens hsa-miR-217-5p mature miRNA
Sequence 35 - UACUGCAUCAGGAACUGAUUGGA - 57
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-217-3p

Accession MIMAT0037308
Description Homo sapiens hsa-miR-217-3p mature miRNA
Sequence 72 - CAUCAGUUCCUAAUGCAUUGCC - 93
Evidence not_experimental

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540