MIR217 is a type of microRNA that has been studied in various tumor types, including KIRP [PMC7744790]. In type 2 KIRP, the expression of IGF2BP3, NCAPG, and MIR217 was found to be higher compared to type 1 KIRP [PMC7744790]. In a study using 6DT1 cells, the expression of Mir216b and MIR217 resulted in a significant suppression of pulmonary metastasis [PMC3912413]. MIR217, along with miR-34a, has been shown to downregulate the mRNA and protein levels of silent information regulator 1 (SIRT1), leading to weakened antioxidant capacity and vascular endothelial aging [PMC9513221]. The relationship between LINC01268, MIR217, and SOS1 was explored in AML cells (HL-60 and Kasumi-1), where their effects on cell viability, cycle progression, and apoptosis were determined [PMC7326380]. Additionally, MIR217 has been found to interact with several splicing factors and bind to miRNAs such as miR-101, miR-9, miR-125b [PMC6351443]. The expression level of MIR217 was downregulated in TNBS-induced inflammation but significantly upregulated by BEY-treatment [PMC9101272].
aguauaauuauuacaua uu c c a C C U - aag guuu gaugu g ag UA UGCAU AGGAACUGAU G GAu a |||| ||||| | || || ||||| |||||||||| | ||| caaa cuacg c uC GU ACGUA UCCUUGACUA c cug a --------------gaa -u a u C U A C a acu
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0000274 |
Description | Homo sapiens hsa-miR-217-5p mature miRNA |
Sequence | 35 - UACUGCAUCAGGAACUGAUUGGA - 57 |
Evidence |
experimental
cloned [2] |
Database links | |
Predicted targets |
Accession | MIMAT0037308 |
Description | Homo sapiens hsa-miR-217-3p mature miRNA |
Sequence | 72 - CAUCAGUUCCUAAUGCAUUGCC - 93 |
Evidence | not_experimental |
|