miRBase entry: hsa-mir-217

Stem-loop hsa-mir-217


Accession
MI0000293
Symbol
HGNC: MIR217
Description
Homo sapiens hsa-mir-217 precursor miRNA
Gene family
MIPF0000077; mir-217

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR217 is a type of microRNA that has been studied in various tumor types, including KIRP [PMC7744790]. In type 2 KIRP, the expression of IGF2BP3, NCAPG, and MIR217 was found to be higher compared to type 1 KIRP [PMC7744790]. In a study using 6DT1 cells, the expression of Mir216b and MIR217 resulted in a significant suppression of pulmonary metastasis [PMC3912413]. MIR217, along with miR-34a, has been shown to downregulate the mRNA and protein levels of silent information regulator 1 (SIRT1), leading to weakened antioxidant capacity and vascular endothelial aging [PMC9513221]. The relationship between LINC01268, MIR217, and SOS1 was explored in AML cells (HL-60 and Kasumi-1), where their effects on cell viability, cycle progression, and apoptosis were determined [PMC7326380]. Additionally, MIR217 has been found to interact with several splicing factors and bind to miRNAs such as miR-101, miR-9, miR-125b [PMC6351443]. The expression level of MIR217 was downregulated in TNBS-induced inflammation but significantly upregulated by BEY-treatment [PMC9101272].

Literature search
100 open access papers mention hsa-mir-217
(638 sentences)

Sequence

8853 reads, 248 reads per million, 44 experiments
aguauaauuauuacauaguuuuugaugucgcagaUACUGCAUCAGGAACUGAUUGGAuaagaaucagucacCAUCAGUUCCUAAUGCAUUGCCuucagcaucuaaacaag
.(((.......)))...((((..(((((.(.((.((.(((((.((((((((((.((((........))).).)))))))))).))))).)).)).).))))).))))...

Structure
aguauaauuauuacaua    uu     c c  a  C     C          U -   aag 
                 guuu  gaugu g ag UA UGCAU AGGAACUGAU G GAu   a
                 ||||  ||||| | || || ||||| |||||||||| | |||    
                 caaa  cuacg c uC GU ACGUA UCCUUGACUA c cug   a
--------------gaa    -u     a u  C  U     A          C a   acu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 55982967-55983076 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-217
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-217 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-217-5p

Accession MIMAT0000274
Description Homo sapiens hsa-miR-217-5p mature miRNA
Sequence 35 - UACUGCAUCAGGAACUGAUUGGA - 57
Evidence experimental
cloned [2]
Database links
Predicted targets

Mature hsa-miR-217-3p

Accession MIMAT0037308
Description Homo sapiens hsa-miR-217-3p mature miRNA
Sequence 72 - CAUCAGUUCCUAAUGCAUUGCC - 93
Evidence not_experimental

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540