Mature dme-miR-184-5p
| Accession | MIMAT0000330 |
| Description | dme-miR-184-5p mature miRNA |
| Hairpins | |
| Sequence | CCUUAUCAUUCUCUCGCCCCG |
| Evidence |
experimental
cloned [2], 454 [3-4], Illumina [4] |
| Database links |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20671708 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20671708 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20671708 |
