| Accession | MIMAT0000332 |
| Description | dme-miR-274-5p mature miRNA |
| Hairpins | |
| Sequence | UUUGUGACCGACACUAACGGGUA |
| Evidence |
experimental
Northern [1], 454 [2-3], Illumina [3] |
| Database links |
|
| Predicted targets |
|
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.