| Accession | MIMAT0000333 | 
            
                | Description | dme-miR-275-3p mature miRNA | 
            
                | Hairpins |  | 
            
                | Sequence | UCAGGUACCUGAAGUAGCGCGCG | 
            
                | Evidence | experimental Northern [1], cloned [2], 454 [3-4], Illumina [4]
 | 
            
               
                                
                             
                                
                                  
                                    | Database links |   | 
    
                                
                                
                                    | Predicted targets |   | 
                 
        
    
  
  QuickGo Function
  
                    
  QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.