Accession | MIMAT0000399 |
Description | dme-miR-308-3p mature miRNA |
Hairpins | |
Sequence | AAUCACAGGAUUAUACUGUGAG |
Evidence |
experimental
cloned [1], 454 [2-3], Illumina [3] |
Database links |
![]() |
Predicted targets |
![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15989958 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23336071 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15989958 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23336071 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:37358278 | |
involved_in | GO:0017148 negative regulation of translation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23910663 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:15989958 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23336071 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:37358278 | |
involved_in | GO:0043066 negative regulation of apoptotic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:15989958 | |
involved_in | GO:0061057 peptidoglycan recognition protein signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:37358278 |