Mature hsa-let-7i-5p
| Accession | MIMAT0000415 |
| Description | hsa-let-7i-5p mature miRNA |
| Hairpins | |
| Sequence | UGAGGUAGUAGUUUGUGCUGUU |
| Evidence |
experimental
cloned [2-3], Illumina [5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17660297 | has_input UniProtKB:O00206 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17660297 | has_input UniProtKB:O00206 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27784773 | has_input UniProtKB:P42081 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28844675 | has_input UniProtKB:P35228 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27784773 | has_input UniProtKB:P42081 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28844675 | has_input UniProtKB:O00206 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17660297 | has_input UniProtKB:O00206 |
| involved_in | GO:0042832 defense response to protozoan |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:17660297 | occurs_in CL:1000488 |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
| located_in | GO:0005737 cytoplasm |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25336585 | part_of CL:0000084 |
| located_in | GO:1903561 extracellular vesicle |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:28798470 | produced_by CL:0000182 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
