Accession | MIMAT0000417 |
Description | hsa-miR-15b-5p mature miRNA |
Hairpins | |
Sequence | UAGCAGCACAUCAUGGUUUACA |
Evidence |
experimental
cloned [2-5] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0001569 branching involved in blood vessel morphogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23688497 | occurs_in UBERON:0007777 |
acts_upstream_of | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23688497 | |
acts_upstream_of | GO:0045719 negative regulation of glycogen biosynthetic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26179126 | occurs_in UBERON:0002107 |
acts_upstream_of | GO:0050728 negative regulation of inflammatory response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29961672 | |
acts_upstream_of | GO:0061045 negative regulation of wound healing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23688497 | |
acts_upstream_of | GO:1901223 negative regulation of non-canonical NF-kappaB signal transduction |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:29961672 | |
acts_upstream_of | GO:1902430 negative regulation of amyloid-beta formation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | has_output UniProtKB:P05067-PRO_0000000092 |
acts_upstream_of | GO:1902992 negative regulation of amyloid precursor protein catabolic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | has_output UniProtKB:P05067-PRO_0000000090 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23688497 | occurs_in CL:0002618 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26179126 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26440600 | has_input UniProtKB:P56817 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18449891 | has_input UniProtKB:P10415 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23688497 | occurs_in CL:0002618 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25261849 | has_input UniProtKB:P23443 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25594541 | has_input UniProtKB:O14757 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26179126 | has_input UniProtKB:P06213 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28254819 | has_input UniProtKB:Q9Y243 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29207665 | has_input UniProtKB:P56817 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | has_input UniProtKB:O15111 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | has_input UniProtKB:P19838 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29961672 | has_input UniProtKB:P56817 |
involved_in | GO:0003300 cardiac muscle hypertrophy |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|