Mature hsa-miR-27b-3p
| Accession | MIMAT0000419 |
| Description | hsa-miR-27b-3p mature miRNA |
| Hairpins | |
| Sequence | UUCACAGUGGCUAAGUUCUGC |
| Evidence |
experimental
cloned [2-5] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21562928 | has_input UniProtKB:A0A087WU25 |
| acts_upstream_of | GO:0032760 positive regulation of tumor necrosis factor production |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:20164187 | occurs_in CL:0000235 |
| acts_upstream_of | GO:0045599 negative regulation of fat cell differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:19800867 | |
| acts_upstream_of | GO:0051001 negative regulation of nitric-oxide synthase activity |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25795136 | has_input UniProtKB:P29474 |
| acts_upstream_of | GO:0061766 positive regulation of lung blood pressure |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25795136 | |
| acts_upstream_of | GO:1901202 negative regulation of extracellular matrix assembly |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28095798 | occurs_in CL:0002553 |
| acts_upstream_of | GO:1901203 positive regulation of extracellular matrix assembly |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30729664 | occurs_in CL:2000067 |
| acts_upstream_of | GO:1904761 negative regulation of myofibroblast differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28095798 | occurs_in CL:0002553 |
| acts_upstream_of | GO:1905111 positive regulation of pulmonary blood vessel remodeling |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:25795136 | occurs_in UBERON:0002012 |
| acts_upstream_of | GO:1990776 response to angiotensin |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30729664 | occurs_in CL:2000067 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19800867 | has_input UniProtKB:P37231 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:20164187 | has_input UniProtKB:P37231 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22120719 | has_input UniProtKB:P37231 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25795136 | has_input UniProtKB:P37231 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:29608331 | has_input UniProtKB:P37231 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:16982751 | has_input UniProtKB:Q16678 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19800867 | has_input UniProtKB:P37231 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:20164187 | has_input UniProtKB:P37231 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:21536891 | has_input UniProtKB:O43597 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22120719 | has_input UniProtKB:P37231 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22184411 | has_input UniProtKB:Q9H2E6 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24177325 | has_input UniProtKB:P07996 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24177325 | has_input UniProtKB:P29353 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24177325 | has_input UniProtKB:P35442 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24177325 | has_input UniProtKB:O43597 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
