Mature hsa-miR-30b-5p
| Accession | MIMAT0000420 |
| Description | hsa-miR-30b-5p mature miRNA |
| Hairpins | |
| Sequence | UGUAAACAUCCUACACUCAGCU |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22387553 | has_input UniProtKB:O15524 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22387553 | has_input UniProtKB:P41182 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23086751 | has_input UniProtKB:Q9NR61 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27464494 | has_input UniProtKB:P13612 |
| involved_in | GO:0001934 positive regulation of protein phosphorylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28977001 | occurs_in CL:0000071 |
| involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28977001 | has_input UniProtKB:P61812 |
| involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28977001 | occurs_in CL:0000071 |
| involved_in | GO:0030511 positive regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28977001 | occurs_in CL:0000071 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22387553 | has_input UniProtKB:P41182 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23086751 | has_input UniProtKB:Q9NR61 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27464494 | has_input UniProtKB:P13612 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28977001 | has_input UniProtKB:Q8WYK2 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| involved_in | GO:0042104 positive regulation of activated T cell proliferation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22387553 | |
| involved_in | GO:0045590 negative regulation of regulatory T cell differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:22387553 | |
| involved_in | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| involved_in | GO:0061886 negative regulation of mini excitatory postsynaptic potential |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0071773 cellular response to BMP stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| involved_in | GO:1900118 negative regulation of execution phase of apoptosis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23968872 | occurs_in CL:4030032 |
| involved_in | GO:1900272 negative regulation of long-term synaptic potentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
