Accession | MIMAT0000431 |
Description | hsa-miR-140-5p mature miRNA |
Hairpins | |
Sequence | CAGUGGUUUUACCCUAUGGUAG |
Evidence |
experimental
cloned [2-3] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24928442 | has_input UniProtKB:Q13950 |
acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24928442 | has_input UniProtKB:Q99717 |
acts_upstream_of | GO:0032088 negative regulation of NF-kappaB transcription factor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:30233718 | |
acts_upstream_of | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30321456 | occurs_in CL:0000576 |
acts_upstream_of | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30321456 | occurs_in CL:0000576 |
acts_upstream_of | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24928442 | occurs_in CL:0000134 |
acts_upstream_of | GO:0060392 negative regulation of SMAD protein signal transduction |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:24928442 | |
acts_upstream_of | GO:1900016 negative regulation of cytokine production involved in inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30321456 | occurs_in CL:0000576 |
acts_upstream_of_or_within | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:Q15303 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:P11047 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:Q15303 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24928442 | has_input UniProtKB:P12643 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:30233718 | has_input UniProtKB:O00206 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18320040 | has_input UniProtKB:P15692 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23401231 | has_input UniProtKB:P31371 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23401231 | has_input UniProtKB:P36897 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:O14672 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:P11047 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:P26367 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:Q15303 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24530397 | has_input UniProtKB:Q8WUI4 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24928442 | has_input UniProtKB:P12643 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|