miRBase entry: hsa-mir-140

Stem-loop hsa-mir-140


Accession
MI0000456
Symbol
HGNC: MIR140
Description
Homo sapiens hsa-mir-140 precursor miRNA mir-140
Gene
family?
RF00678; mir-140

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR140 is a microRNA implicated in various physiological processes, including embryogenesis, where it is involved in epigenetic modifications [PMC7890887]. In the context of skeletal development, MIR140 plays a distinct role in epiphyseal maturation, as evidenced by the delayed epiphyseal maturation observed in SED MIR140 type Nishimura [PMC6622181]. This contrasts with conditions like acrodysostosis, where there is an advancement of epiphyseal ossification, particularly in the carpal bones [PMC6622181]. The involvement of MIR140 in these developmental processes underscores its significance in bone development and the potential consequences of its dysregulation.

Literature search
217 open access papers mention hsa-mir-140
(1445 sentences)

Sequence

2756121 reads, 5164 reads per million, 144 experiments
ugugucucucucuguguccugcCAGUGGUUUUACCCUAUGGUAGguuacgucaugcuguucUACCACAGGGUAGAACCACGGacaggauaccggggcacc
.(((((((.....((((((((((.(((((((((((((.(((((((.((.((...)))).))))))).))))))))))))))).)))))))).))))))).

Structure
u       ucucu        -  A             A       u  c  c 
 gugucuc     guguccug cC GUGGUUUUACCCU UGGUAGg ua gu  
 |||||||     |||||||| || ||||||||||||| ||||||| || || a
 cacgggg     cauaggac GG CACCAAGAUGGGA ACCAUcu gu cg  
c       ----c        a  -             C       u  -  u 


Annotation confidence High
Do you think this miRNA is real?
Comments
This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
chr16: 69933081-69933180 [+]

Disease association
hsa-mir-140 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-140-5p

Accession MIMAT0000431
Description Homo sapiens hsa-miR-140-5p mature miRNA
Sequence 23 - CAGUGGUUUUACCCUAUGGUAG - 44
Evidence experimental
cloned [2-3]
Database links
Predicted targets

Mature hsa-miR-140-3p

Accession MIMAT0004597
Description Homo sapiens hsa-miR-140-3p mature miRNA
Sequence 62 - UACCACAGGGUAGAACCACGG - 82
Evidence experimental
cloned [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 12007417
    Identification of tissue-specific microRNAs from mouse
    "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
    "Curr Biol (2002) 12:735-739

  4. PubMed ID: 15800047
    Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
    "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
    "Proc Natl Acad Sci U S A (2005) 102:5570-5575