Stem-loop hsa-mir-140

Accession

MI0000456

Symbol

HGNC: MIR140

Description

Homo sapiens hsa-mir-140 precursor miRNA mir-140

Gene
family

RF00678; mir-140

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR140 is a type of microRNA that has been studied in relation to various physiological processes, including embryogenesis mediated by epigenetic modifications [PMC7890887]. In SED MIR140 type Nishimura, epiphyseal maturation is delayed, while in acrodysostosis, particularly carpal ossification, is advanced [PMC6622181]. These findings suggest that MIR140 plays a role in skeletal development and maturation [PMC6622181]. Additionally, miR29 has also been implicated in embryogenesis mediated by epigenetic modifications [PMC7890887]. These microRNAs may be involved in regulating gene expression and influencing the development of various tissues and organs during embryogenesis [PMC7890887]. Further research is needed to fully understand the specific mechanisms by which MIR140 and miR29 contribute to these processes. However, these studies highlight the importance of microRNAs in embryonic development and suggest their potential as therapeutic targets for developmental disorders.

Literature search

217 open access papers mention hsa-mir-140
(1445 sentences)

Sequence

2756122 reads, 8526 reads per million, 144 experiments

ugugucucucucuguguccugcCAGUGGUUUUACCCUAUGGUAGguuacgucaugcuguucUACCACAGGGUAGAACCACGGacaggauaccggggcacc
.(((((((.....((((((((((.(((((((((((((.(((((((.((.((...)))).))))))).))))))))))))))).)))))))).))))))).

Structure

u       ucucu        -  A             A       u  c  c 
 gugucuc     guguccug cC GUGGUUUUACCCU UGGUAGg ua gu  
 |||||||     |||||||| || ||||||||||||| ||||||| || || a
 cacgggg     cauaggac GG CACCAAGAUGGGA ACCAUcu gu cg  
c       ----c        a  -             C       u  -  u 

Annotation confidence High

Comments

This miRNA sequence is predicted based on homology to a verified miRNA from mouse [1]. Its expression was later verified in human [2,3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

chr16: 69933081-69933180 [+]

Disease association

hsa-mir-140 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-140-5p

• Accession: MIMAT0000431
• Description: Homo sapiens hsa-miR-140-5p mature miRNA
• Sequence: 23 - CAGUGGUUUUACCCUAUGGUAG - 44
• Evidence: experimental ; cloned [2-3]

Mature hsa-miR-140-3p

• Accession: MIMAT0004597
• Description: Homo sapiens hsa-miR-140-3p mature miRNA
• Sequence: 62 - UACCACAGGGUAGAACCACGG - 82
• Evidence: experimental ; cloned [3-4]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 17616659
   Patterns of known and novel small RNAs in human cervical cancer
   "Lui WO, Pourmand N, Patterson BK, Fire A"
   "Cancer Res (2007) 67:6031-6043


3. PubMed ID: 12007417
   Identification of tissue-specific microRNAs from mouse
   "Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T"
   "Curr Biol (2002) 12:735-739


4. PubMed ID: 15800047
   Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells
   "Cai X, Lu S, Zhang Z, Gonzalez CM, Damania B, Cullen BR"
   "Proc Natl Acad Sci U S A (2005) 102:5570-5575