WARNING: This summary was generated by AI. MIR140 is a microRNA implicated in various physiological processes, including embryogenesis, where it is involved in epigenetic modifications [PMC7890887]. In the context of skeletal development, MIR140 plays a distinct role in epiphyseal maturation, as evidenced by the delayed epiphyseal maturation observed in SED MIR140 type Nishimura [PMC6622181]. This contrasts with conditions like acrodysostosis, where there is an advancement of epiphyseal ossification, particularly in the carpal bones [PMC6622181]. The involvement of MIR140 in these developmental processes underscores its significance in bone development and the potential consequences of its dysregulation.
u ucucu - A A u c c gugucuc guguccug cC GUGGUUUUACCCU UGGUAGg ua gu ||||||| |||||||| || ||||||||||||| ||||||| || || a cacgggg cauaggaC GG CACCAAGAUGGGA ACCAUcu gu cg c ----c A - C u - u
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0000431 |
| Description | Homo sapiens hsa-miR-140-5p mature miRNA |
| Sequence | 23 - CAGUGGUUUUACCCUAUGGUAG - 44 |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0004597 |
| Description | Homo sapiens hsa-miR-140-3p mature miRNA |
| Sequence | 62 - UACCACAGGGUAGAACCACGGAC - 84 |
| Evidence |
experimental
cloned [3-4] |
| Database links |
|
| Predicted targets |
|
|