Accession | MIMAT0000445 |
Description | hsa-miR-126-3p mature miRNA |
Hairpins | |
Sequence | UCGUACCGUGAGUAAUAAUGCG |
Evidence |
experimental
cloned [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0030336 negative regulation of cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23437250 | |
acts_upstream_of | GO:0045861 negative regulation of proteolysis |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23437250 | |
acts_upstream_of | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28578351 | occurs_in CL:2000008 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23437250 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23437250 | |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23437250 | |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20619534 | has_input UniProtKB:P46108 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23437250 | has_input UniProtKB:P09237 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23437250 | has_input UniProtKB:Q13443 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23437250 | has_input UniProtKB:O00459 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:O00459 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27780851 | has_input UniProtKB:O43524 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28065883 | has_input UniProtKB:Q7Z699 |
involved_in | GO:0030336 negative regulation of cell migration |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:20619534 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23437250 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23437250 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23437250 | has_input UniProtKB:O00459 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26646931 | has_input UniProtKB:Q13443 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26934179 | has_input UniProtKB:O00459 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27780851 | has_input UniProtKB:O43524 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27780851 | has_input UniProtKB:Q7Z699 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28065883 | has_input UniProtKB:Q7Z699 |
involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20619534 | has_input UniProtKB:P46108 |
involved_in | GO:0043410 positive regulation of MAPK cascade |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0002240 |
involved_in | GO:0043410 positive regulation of MAPK cascade |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:18694566 |
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
---|
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
Disease | Differential expression | Experiment | Year | Study |
---|